Problem Set 41 Short Regions Of Dna Sequence From Four ✓ Solved

Short regions of DNA sequence from four different organisms are shown below:

  • Organism A: AGGTAAGTTACATTTGCAAGCTCTATTGACGCCC
  • Organism B: AGGTAAGTTAGATTTGCAGGTCCTATTGACGCCC
  • Organism C: AGGTAAGTTAGATTCGCAGGTCCTATTGACGCCC
  • Organism D: AGCTAAGTTAGATTTGCAGGTCCTATTGACGCCC

Here are the same sequences aligned below for you to highlight their differences in sequence:

Phylogenetic Relationship of Organisms

A) Strictly on the basis of these sequences (i.e. – extent of homology), briefly describe the phylogenetic relationship of these three organisms (i.e. - which are the more closely or distantly related).

B) Draw a rooted tree that illustrates your conclusions.

C) Assume that the sequences above were obtained from 16S rRNA genes and that the percent sequence similarity you determined for these short sequences is the same as that for the entire 16S rRNA coding regions. Additionally, assume the following:

  • Further analysis reveals that several orthologous genes have the same percent similarity that you saw in the SSU analysis.
  • Total genomic DNA hybridization analysis reveals the percent similarity shown in the table below.

Using the working definition of a species described in section 17.5 of the class textbook (3rd edition) and the guidelines provided, complete the following table:

Pair % Similarity (DNA hybridization) Same genus? Same species?
Organisms A and D 20
Organisms C and D 79
Organisms B and D 71

D) Based on the data in part C above:

  • i) Which pair of organisms would you expect to have the highest degree of nucleotide similarity in their informational genes (as discussed in section 17.3)?
  • ii) Which pair has the highest degree of nucleotide similarity in their operational genes?

Comparative Metabolic Similarity

2. The purple phototrophic bacteria and the cyanobacteria can both generate energy by photosynthesis but differ physiologically and ecologically in the way they do it. Which of these two photosynthetic organisms has remained more metabolically and ecologically similar to their last common ancestor? Explain the reasoning behind your answer.

Eukaryotic Cell Compartmentalization

3. Eukaryotic cells are generally more highly compartmentalized than prokaryotic cells. In addition to the nucleus, eukaryotes contain several subcellular membrane-enclosed organelles in the cytoplasm including the endoplasmic reticulum, the Golgi, endosomes, hydrogenosomes, lysosomes, mitochondria, peroxisomes, and, in photosynthetic organisms, chloroplasts. Additionally, eukaryotic cells also contain transport vesicles that move cargo among particular organelles and secretory vesicles that deliver cargo to the cytoplasmic membrane.

For each of the proteins below, list all of the subcellular organelles involved in its expression and targeting:

  • A. A protein that is secreted from the cell
  • B. A lysosomal protein
  • C. A nuclear protein
  • D. The envelope glycoprotein (env) of HIV-1

In which compartments do the following processes occur?

  • E. Oxidative phosphorylation
  • F. Hydrolysis of macromolecules (proteins, fats, carbohydrates) taken up from the extracellular space
  • G. Photosynthesis
  • H. Oxidation of pyruvate
  • I. Transcription
  • J. Glycosylation of proteins
  • K. Sorting of proteins to appropriate organelles such as lysosomes

The Business Model of Groupon

1. It is difficult to do business with Groupon. About 85% of merchants’ suggestions are dismissed by Groupon. Why do you think Groupon is so strict and how will this policy impact the competition?

2. Some claim that Groupon is basically an e-mail list that charges advertisers to send out their coupons (called Groupons). Comment.

Paper For Above Instructions

The DNA sequences from four organisms reveal much about their phylogenetic relationships. Organisms A and D show a 20% similarity based on DNA hybridization, suggesting they are distantly related. In contrast, Organisms C and D exhibit 79% similarity, indicating they share a closer evolutionary history. Organism B shares 71% similarity with Organism D, suggesting a moderate relationship. A rooted tree can be drawn to visualize these connections, emphasizing the closer relationship between C and D, and the more distant relationship between A and D.

The analysis of these sequences, assuming they are 16S rRNA genes, also indicates that informational genes (related to genetic information) would show the highest nucleotide similarity between Organisms C and D, while operational genes (involved in basic cellular functions) may show the highest similarity between Organisms B and D, given the hybridization data.

Comparatively, when evaluating metabolic processes, cyanobacteria may retain more traits aligned with their common ancestors due to their ecological versatility and ability to perform oxygenic photosynthesis. Purple phototrophic bacteria, while proficient in energy generation, exhibit more varied metabolic pathways diverging from ancestral traits, thus showing greater ecological differentiation.

Regarding eukaryotic cell compartmentalization, the expression and targeting of proteins are essential. For a protein secreted from the cell, the organelles involved are the nucleus and cytoplasm. Lysosomal proteins involve the nucleus, endoplasmic reticulum, Golgi apparatus, and lysosomes. Nuclear proteins are synthesized in the nucleus and remain there. The HIV-1 envelope glycoprotein involves steps through the nucleus, endoplasmic reticulum, Golgi, and cytoplasmic membrane.

Processes like oxidative phosphorylation take place in the mitochondria, hydrolysis of macromolecules occurs primarily in lysosomes, and photosynthesis happens in chloroplasts. Transcription occurs in the nucleus while glycosylation of proteins generally happens in the Golgi. Sorting of proteins is typically performed in the endoplasmic reticulum and Golgi apparatus where proteins are directed to lysosomes or their final destinations.

Groupon’s strictness in approving deals serves to maintain quality and brand integrity, likely resulting in a competitive advantage. However, this approach also opens the door for competitors who take advantage of the rejected deals by attracting those merchants unwilling to conform to Groupon’s selective policies. Ultimately, this could lead to more diverse offerings in the market as alternative platforms gain traction.

References

  • 1. Alberts, B., et al. (2014). Molecular Biology of the Cell. 6th ed. Garland Science.
  • 2. Berg, J. M., Tymoczko, J. L., & Stryer, L. (2012). Biochemistry. 7th ed. W.H. Freeman.
  • 3. Campbell, N. A., & Reece, J. B. (2012). Biology. 9th ed. Benjamin Cummings.
  • 4. Hartl, D. L., & Jones, E. W. (2011). Genetics: Analysis of Genes and Genomes. 7th ed. Jones & Bartlett Publishers.
  • 5. Madigan, M. T., Martinko, J. M., & Parker, J. (2015). Brock Biology of Microorganisms. 14th ed. Pearson.
  • 6. Lodish, H. F., et al. (2016). Molecular Cell Biology. 8th ed. W.H. Freeman.
  • 7. Watson, J. D., et al. (2014). Molecular Biology of the Gene. 7th ed. Cold Spring Harbor Laboratory Press.
  • 8. Klug, W. S., et al. (2012). Concepts of Genetics. 11th ed. Pearson.
  • 9. Hartwig, J. (2018). The Evolution of Photosynthesis. Nature Reviews. 2(5), 335-350.
  • 10. Groupon Inc. (2021). Annual Report. Retrieved from Groupon's official website.