1. How did Natasha’s innate immune system try to protect her from the infection?
ID: 135306 • Letter: 1
Question
1. How did Natasha’s innate immune system try to protect her from the infection? (make sure it is specific for this type of attack) (Natasha has Q fever)
2. Please describe the acquired immune reaction that occurred in response to this infection. (make sure it is specific for this type of attack)
3. You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:
TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG
Describe the complete process, step by step, that this protein plays a role in.
Explanation / Answer
1. Q fever is caused by Coxiella burnetii. Plasmacytoid dendritic cells play an important role in innate immunity via the production of type I interferon. Coxiella burnetii interact with Plasmacytoid dendritic cells that resulted in the increased the expression of activation CD86 and CCR7. Genes responsible for coding chemokines,type I INF , cytokines, chemokines,were up-regulated.