Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

4.) To gain nsights into how promoter activity can be calculated using ImageJ/Fi

ID: 144209 • Letter: 4

Question

4.) To gain nsights into how promoter activity can be calculated using ImageJ/Fiji software, we will use an example of a mutant promoter with a one nucleotide base change. This mutant promoter (P5-33A) has reduced RNA polymerase binding; this results in decreased rate of a gene being transcribed P5 Promoter 5 CGACTTGACAATTAATCATCCGGCTCGTAAT TARCTEGA AACTGTTAATTAGTAGGCCGAGCATTAAATACAConcaco P5-33A Promoter AATTGTTAATTAGTAGGCCGAGCATAAATACA Legend: wild type P5 promoter shown above; highlighted base pair change in P5-33A Promoter Additional defined terms for acronyms on plasmid map of pClone GFP, Green fluorescent protein RFP, Red fluorescent protein RBS, ribosomal binding site (for translation) 4A.) If there were a mutation in both the ribosomal binding sites on the DNA plasmid, would you expect to see either green or red fluorescent protein? Why? (5 points) 4B.) After comparing the promoter (on left hand side) with and the cloned mutant promoter DNA construct on the right hand side, what do you notice about the direction of the promoter and the fluorescent bacteria colonies being produced? (5 points)

Explanation / Answer

4A. The answer is NO. Ribosomal binding site (RBS) is very important component of the mRNA for the ribosome to bind and scan the mRNA for the initiation codon to start the protein synthesis. If the sequence is mutated, then there would be no ribosomal binding to the GFP/RFP mRNA and thus no protein synthesis.

4B. There is no image you have uploaded which shows the (left hand side) and (right hand side) to compare. We need additional image of the plasmid map (pClone) to answer this question. Please upload the same. Thank you.