Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

21. The following partial sequence comparison relates to a portion of a human co

ID: 149017 • Letter: 2

Question

21. The following partial sequence comparison relates to a portion of a human coding sequence, top, and a mouse sequence, bottom, obtained from a random cDNA library using a probe from the human sequence; based on the characteristics of the human gene, the codons' frame begins with CAG at the left (5), which corresponds to Q, and with the aas that follow it yielding: QKRGIVEQCCTSICSLYQLE CAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAG CAGAAGCGTGGCATTGTAGATCAGTGCTGCACCAGCATCTGCTCCCTCTACCAGCTGGAG One can deduce from the sequence alignment that the genes most probably are....... a. diverging in accord with molecular clock rates (we would expect the differences since humans and mice shared a common ancestor 80 million years ago). b. are not conserved at all due to the several observable changes present. c. are strongly conserved and purged of changes via purifying selection. d. are most probably examples of fortuitous convergent evolution, not any sort of orthologous relationship e. none of the above

Explanation / Answer

By seeing the sequence alignment, we can deduce that sequence present in human and mouse sequence are conserved because most of the nucleotide are showing match. Very few are mis-match. Hence, the option c is correct.