This sequence is what you have used to identify a -10 site and a transcript. 5’
ID: 151433 • Letter: T
Question
This sequence is what you have used to identify a -10 site and a transcript.
5’ T C G C A A T A T G A A T A C G A G C A T T A T A G A C T T G T G 3’
3’ A G C G T T A T A C T T A T G C T C G T A A T A T C T G A A C A C 5’
Identify which strand is the nontemplate strand and write the conserved consensus sequence of the sigma binding site upstream of the site shown here. The answer may or may not be included in the sequence provided.
Write ONLY the nucleotides of the DNA sequence in 5' --> 3'. Do NOT include any numbers, dashes or spaces.
Explanation / Answer
Non template strand is 5'TCGCAATATGAATACGAGCATTATAGACTTGTG3'
Sigma is a initiation factor which recognizes and bind with consensus sequence unstream of the start site .Sigma contain two subunit sigma2 which binds with -10 site which shown here ,but this site is consensus and sequence is 5'TATAAT3' .And Sigma 4 binds with -35 region unstream of the -10 site and the sequence of this site is 5'TTGACA3'.
If u like the answer please press like