Apal AatII AGT CAC ACGTTGTAAAAC GACGGCCA GTGAATTOTAA TACO AC TCACTATAGGGEGAATT G
ID: 161732 • Letter: A
Question
Apal AatII AGT CAC ACGTTGTAAAAC GACGGCCA GTGAATTOTAA TACO AC TCACTATAGGGEGAATT GGGCCCGACGTCGCAT CTCCCGG TCAG TGCTGCAACATTT TGCTGCCGGT CACTTAACATTATGCTGAG TGA TATCCCGC T TAA CCC iGGCTGCAGC G TAC GAGGGCC Aecl Bst21 EcoRV SacI Styl SIMI Noel SacII coRI coRI PstI CCGCCATOGC GGCCGCGGGAAT TCGATAT CACTAGTGAAT TCGC GGCCGCCTOCAG GTCGACCATATOGGAGA GCTCC CAACGCG Cloned DNA nsertion site TTG RAT CATAGCTT GASTA TTCTA TAGTOTCACCTAAA TA ICTTOGCOTAATCATOSTCATA 6CTGTTTCCTGTGT6AAATTGT AACC ACGTA TCGAACTCATAA GATAT CACAG TGGATTTA TCGAACCGCATTAGTACCAGTATCGACAAAGGA CACACTTTAACA lac operator Figure 1. Multiple Cloning Site Region of pGEM T-Easy vector In this diagram, recall the location of the insertion site. It was created by digesting the plasmid with the enzyme EcoR V. Note its position here Question: Determine the primer sequences we must use for the M13 primers. (5) The binding sites for these are shown as the M13 fiwd site and the M13 rev site. So, provide the sequences written as 5 to 3 of the actual primers themselves. Keep in mind that extension from PCR primers comes from the 3' end (so that end must be "pointing" towards the cloning insertion site at the EcoR V cutsite (also shown by pink box "Cloned DNA Insertion Site Think about what direction the DNA polymerase must extend a new strand from the primer and where the 5 and 3' ends or the primer would be. See if you can do this yourself first. M13 fwd sequence (5 3') M13 Rev sequence (5 3')Explanation / Answer
Answer- Primer is a short sequences which required at the initial part of newly synthesized DNA.At the point where primer locates it contains complementary bases to pair with DNA bases and form a hybrid.primers always extend in 5'-3' direction .
Because primer contains complementary bases for DNA to bind with it,we can determine the sequence of primer by using DNA sequence which is bind to primer.
In our question there are 2 primers M13 fwd and M 13 Rev both have their end points (3') towards cloning insertion site.
The sequence for the forward M13 primer will be
5' GUAAAACGACGGAG 3'
Which is complementary to the DNA strand in forward direction( lower strand)
3'CATTTTGCTGCCTC 5'
The sequence for the reverse M 13 primer.
5'CAGGAAACAGCTATGA3'
Which is complementary to the sequence of reverse DNA strand.(upper strand)
3'GTCCTTTGTCGATAC 5'
Both M13 primer (forward and reverse ) expand newly synthesized DNA in 5'-3' direction by adding nucleotide to its 3' end and they use seperate DNA strand as a template to add complementary DNA.