1. How do intercalating agents such as ethidium bromide and cisplatin interact w
ID: 161814 • Letter: 1
Question
1. How do intercalating agents such as ethidium bromide and cisplatin interact with DNA secondary structure? Why are these compounds toxic to cells? Reference your sources
2. Identify where one of the siRNA strands will bind to the mRNA.
mRNA
3’ AUGCCCGGAUGCUAUAGCGCGCAUCAUACGCAUUGCGAAUAUU 5’
siRNA
3’ AUUCGCAAUG 5’
5’ UAAGCGUUAC 3’
3. Assemble the secondary structure of this miRNA. Refer to figure 11.15 in the text to see what this might look like.
5’ CGCGAAGUUAUGAACGCUACGGGAACACGUUCAUAACUUCGUAAU 3’
Explanation / Answer
Ehtidium Bromide an agent which is generally used in the laboratory viualizing DNA structures, and it is a large planner molecule. This molecule finds itself inserted between the stacked bases in double-stranded DNA. This ring structured molecule is hydrohobic in nature and having close Van der Walls contacts with base pairs of DNA. Thus this intercalating agent intercalate itself between the packed bases, (1).
An anti-cancer drug like cisplatin affects the structure of DNA even in the low concentration, DNA become more flexible, while the persistance length decreased significantly from approximately 52 to 15nm. First they attack by di-adducts inducing local distortions then forming micro looks size approximately 20nm. (2).
Reference: 1. Reha D, Kabelac M, Ryjacek F, Sponer J, Sponer J. E, Elstner M, Suhai S, and Hobza P, Intercaletors. Nature of stacking interactions between intercalators (ethidium bromide, daunomycin, ellipticine, and 4' , 6-diaminide-2-phenylindole) and DNA base pairs, (2003). Ab initio quantum chemical, density functional theory, and empirical potential study. J. Am. Chem. Soc. 124:3366-76.
2. Xi-Miao Hou, Xing-Hua Zhang, Kong-Ji Wei, Chao Ji, Shuo-Xing Dou, Wei-Chi Wang, Ming Li, and Peng-Ye Wang*.. Cisplatin induces loop structures and condensation of single DNA molecules, (2009). Nucleic Acids Res. 1400-1410, doi: 10.1093/nar/qkn933.
Both of these agents are finally interfare with DNA replication, transcription, DNA repair mechanism and recombination. These are the main causes DNA is damaged and hampared with their normal funtionalities. Thus cells are directly malfunctioned through these agents.
2. si RNA or silencing RNA interfares with the mRNA expression. The actual double starnded structure of siRNA thus binds to the complementary bases of mRNA and iterfares with its action to express, and it degrades it after transcription. So the second strand starting 5' UAAGCGUUAC 3' to be connected to the mRNA strand with its complementary bases of AUU and so on in the strand of mRNA.
3. To answer this we need to know the fundamental rule of RISC factor binding. Generally from various research work we have seen that miRNA binds to the mRNA in the 3'UTR site and the most effective site are 8mers/canonical sites. So here also we can make out the 3'UTR site in the mRNA.