What is the purpose of DNA? What is the shape of DNA? List the four bases of DNA
ID: 162794 • Letter: W
Question
What is the purpose of DNA? What is the shape of DNA? List the four bases of DNA. If the template DNA strand has the bases GCATTCGA what would the complimentary strand of the DNA molecule be? DNA contains the sugar ___, while RNA contains the sugar ___. During DNA replication, two DNA strands are produced. Each new DNA molecule has one strand and one ___ strand. The bases in DNA and RNA are the same except that RNA has ___ and does not a have ___. When making a protein, DNA is converted into ___, which is then converted into a ___. If a hypothetical protein is 450 amino acid long, how many DNA bases is in the coding sequence? DNA sequence: TACCAGTAGGTTAGCCAAATT mRNA sequence: Amino acid sequence:Explanation / Answer
1.The purpose of DNA is to carry the genetic information of a cell that is required for various activities of the organisms such as growth,development,reproduction and other functioning.Another purpose is the synthesis of mRNA through transcription that goes on to produce proteins via translation to carry out all the vital functions of the organisms.
2.The shape of DNA is a double helix shape.It has two helical strands that are coiled around the same axis and bound to each other by complementary base pairing through hydrogen bonds.
3.The four bases of DNA are adenine,guanine,cytosine and thymine.
4. GCATTCGA.....template strand
CGTAAGCT....complementary strand
5.DNA contains sugar deoxyribose while RNA contains the sugar ribose.
6.During DNA replication,two strands are produced.Each new DNA molecule has one parental strand and one newly synthesised DNA strand.
7.The bases in DNA and RNA are the same except that RNA has uracil and does not have thymine.
8.When making a protein,DNA is converted into mRNA or messenger RNA which is then converted into a protein.
9.Since a triplet code consists of three bases that codes for 1 aminoacid therefore for 450 aminoacid long protein , the DNA bases will be 450*3 = 1350.
10.
DNA sequence : T A C C A G T A G G T T A G C C A A A T T
mRNA sequence: A U G / G U C/ A U C/ C A A/ U C G/ G U U /U A A
Aminoacid : Met - Val - Ile - Gln - Ser - Val - Stop