3. Tumor suppressor genes are genes that function normally to ‘protect’ cells fr
ID: 164772 • Letter: 3
Question
3. Tumor suppressor genes are genes that function normally to ‘protect’ cells from becoming cancerous by regulating essential cellular processes. When these genes are mutated, not expressed, or non-functional, a cell can progress to cancer. One such gene in humans is called TP53, which encodes the protein P53, which is the most frequently altered gene in human cancers.
A) On your own researchTP53 and briefly describe what type of protein P53 is and how it functions. Does the p53 protein impact expression of other genes?
B) Below is the promoter region of TP53, showing only the coding strand. How many potential DNA methylation sites are there in the TP53 promoter region? 5’TTCCTCCGGCAGGCGGATTACTTGCCCTTACTTGTCATGGCGACTGTCCAGCTGT GCCAGGAGCCTCGCAGCGCGGTTGATGGGATTGGGGTCGCCCGT3’
C) A breast cancer patient is undergoing testing in efforts to identify the most efficient treatment therapy. It was found that breast cancer cells from this patient are all wildtype for the TP53 gene, but have increased levels of methylation of the TP53 promoter compared to normal breast cells. How would DNA methylation of the TP53 promoter contribute to the progression of cancer?
Explanation / Answer
A. Given that p53 is a tumor suppressor gene which gives us the idea that it might be regulating genes which participate in cell cycle progression. It can regulate gene by two processes either by regulating their expression level or by regulating the activity of the protein.
B. DNA methylation takes place on the cytosine when present in CpG combination where C is cytosine p phosphate and G fro guanine.
5’TTCCTCCGGCAGGCGGATTACTTGCCCTTACTTGTCATGGCGACTGTCCAGCTGT GCCAGGAGCCTCGCAGCGCGGTTGATGGGATTGGGGTCGCCCGT3’
all the probable site are bold and underlined and they are eight in number.
C. DNA methylation is a type of gene repression in which DNA gets methylated at Cytosine of CpG group. Due to DNA mehtylation RNA polymerases is not able to detect its binding site on the promoter as a result of ti there is no transcription which leads to gene repression.
In the case of p53 which is a tumor suppressor gene if p53 is unable to express which lead to uncontrolled cell division.