Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Show below is a double-stranded bacterial (S. enteric) DNA sequence coding for a

ID: 165892 • Letter: S

Question

Show below is a double-stranded bacterial (S. enteric) DNA sequence coding for a hypothetical protein. Both are strands are shown: the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. GTGTCCGTCIAATATTGTGAGATGTTATATCCCGCCGTCAACACCATCAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3' 3' CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTTTGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5' What are the first five amino acids translated from the resulting mRNA? Place them in order from left to right and use the three-letter abbreviation. Please leave a space between each amino acid abbreviation. You are allowed to use the codon chart in your book/online. Fill in the blank

Explanation / Answer

Only one of the two DNA strands acts as template for the RNA synthesis via transcription. The antisense strand is read by RNA polymerase. The antisense strand runs from 3'--->5' direction. It is complementary to sense strand which runs from 5'---->3'.

[We have to tell five amino acids so I am writing sequence for five amino acids only.

Template DNA: 3'--- GAT TAT AAC ACT CTA --- 5'

mRNA: 5'---- CUA AUA UUG UGA GAU---3'

Protein: Leu- Ile- Leu- Stop