Template DNA: 3\'--- GAT TAT AAC ACT CTA --- 5\' mRNA: 5\'---- CUA AUA UUG UGA G

Question

Template DNA: 3'--- GAT TAT AAC ACT CTA --- 5'

mRNA: 5'---- CUA AUA UUG UGA GAU---3'

Protein: Leu- Ile- Leu- Stop

Show below is a double-stranded bacterial (S. enteric) DNA sequence coding for a hypothetical protein. Both are strands are shown: the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. 5' GT GT CCGTCTAATATTGT GAG AT GTTATAT CCCGCCGT C AAC ACC AT CAAAC AGG ATAAT CGCCTGCT GGGGC AAAGGCGGT GAAGGTAAAGGT GTTGCC 3' 3' CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTTTGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5' in this cell, which protein recruit's RNA polymerase to the promoter? Fill in the blank

Explanation / Answer

Answer is Enhancers

enhancers are the sequence of DNA near or far from promotor still they support or regultes the RNApolymerase recruitment.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

---