lac operon and gene regulation 35 s cgcaacgcaattaat gtgagttagotoactcattaggcacocc
ID: 170413 • Letter: L
Question
lac operon and gene regulation35 s cgcaacgcaattaat gtgagttagotoactcattaggcacoccaggott ttat 3 cgogttgogttaattacactcaatcgagtgagtaa. tccgtggggtccgaaatgt gaaata. 5 OPERATOR cacaca gottccggotcg tatgttgtgtggaAttgtgagoggataacaattt aggaaacag 120 3 cgaaggccgagcatacaaca actcgcotattgttaaagtgtgtcotttgte caccettaac Lacz CDS 5 ttta 180 gatactggtactaatgcotaagtgacoggcagcaaaatgttgcagcactgacccttttgg The above sequence shows a partial sequence of the lac operon which contains the following elements. CRP Binding site -35 and -10 promoter operator binding site sequence the transcriptional start site RBS ribosomal binding site The initial 58 bps of the Lacz coding sequence (cDs)- in other words the sequence that encodes for lac Z. 1. Use the above information to answer the following: A What would be the first 20 bases, starting from the 5' end of the mRNA sequence? B. What is the purpose of the -38 and -10 and what protein binds to it? What is the meaning behind numbers? C. What is the RNA sequence of the 5'UTR (untranslated region). D. What is the RNA sequence of the ribosomal binding site. E. What are the first 5 amino acid sequences for lac z (you will be given the universal table in class)? F. would happen to the resulting protein sequence if we were to delete 2 bases from position 91-92? 1) what is the difference between an operator and a promoter 2) nlustrate and explain an operon that is subject to both positive and negative control containing the operator region, the operon, the promoter, the activator binding site, and the functional genes in a DNA sequence. Also compare and contrast the roles activators and repressors have in regulating the illustrated operon. 3) Explain the function of CAMP in catabolite repression. Explain the sequence of events that would follow the addition of lactose to a growing culture of E. ocli that was initially supplemented with glucose 30 minutes prior, Draw a growth curve illustrating what would happen.
Explanation / Answer
1.
A. Ribosomal binding site
B. -35 and -10 region are promoter binding site . It means that upstream region of transcription genes
C. Located in first exon of the gene, not part of the promoter for RNA polymerase not normally transcribed.
D. Ribosomal binding site in mRNA at the 5' end
E. It affect the operator binding sites
G.
2. In positive control : the regulatory protein is an activator which stimulates transcription
In negative control : the regulatory protein is a repressor, binding DNA and inhibiting transcription
3.Function of cAMP in catabolite repression :
Inhibition of the synthesis of several catabolic enzymes by a preferred carbon and energy source which is glucose.
Operator Promoter 1. it is recognized the repressor protein 1. It is recognized by the RNA polymerase 2. It regulates structural gene synthesis 2. It promotes structural gene synthesis