A cloned fragment of DN A was sequenced by using the dideoxy chain- termination
ID: 173671 • Letter: A
Question
A cloned fragment of DN A was sequenced by using the dideoxy chain- termination method. A part of he autoradiogram of the sequencing gel is represented here. What is the nucleotide sequence of this stretch of DNA? Show both strands and label the 5' and 3' ends. The Crick-Brenner experiments used proflavin to induce mutations at the rII locus in the bacteriophage T4. They isolated the following "plus" mutants: FC 0, FC 40 and FC 58, and the following 'minus' mutants: FC 21, FC22 and FC 23. A. Write two examples of double mutants that should NOT produce the wild type phenotype. B. Write two examples of triple mutants that produce the wild type phenotype.Explanation / Answer
The sequence of the DNA will be interpreted from the bottom, being 5' end. This is because the smaller size runs faster and travels maximum in the gel. Chain has terminated wherever that particular dNTP is encountered.
So the sequence will be :
5'-TTCGAAAGGTGACCCCTGGACCTTTAGA -3'
3'- AAGCTTTCCACTGGGGACCTGGAAATCT -5'