Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Hello, I\'m having trouble understanding the following genetics problem for part

ID: 174516 • Letter: H

Question

Hello, I'm having trouble understanding the following genetics problem for part B. Like I'm not too sure on how to come about with it. It says it affects the WT T4 at the top of the page but i don't understand how new the strand is elongated by 2 new amino acids "Arg & Tyr." Please help me understand how they got the following answer for part B!

3. Below is shown the RNA sequence from the imaginary protein coding region of the rll gene of bacteriophage T4. As you can see the gene encodes a protein that is 7 amino acids long. Met is the first amino acid. Previous analysis shows that the Val-Val-Val amino acids at the C terminus of the protein (underlined below) are all that is required for rll+ activity. You isolate 4 mutations in the gene. Mutation #1 and #2 are both positive frameshift mutations, the base inserted is shown in bold. Mutations #3 and #4 are both minus frameshift mutations, the base missing is shown as a gap in the sequence. II phenotype Wild Type 5 UUAUGCCUGGUAAAGUCGUCGUCUGAUACUAA. rII+ Met ProGlyLysVaival Val Stop #1 5'UU UGCCUGGUAAAGUCIGUCGUCUGAU ACUAA3 rII 5 UUAUGC UGGUAAAGUCGUCGUCUGAUACUA A3 rII 5 UUAUGCCU GUAAA GUCGUCGUCUGAUACUAA3 #3 rII 5 UUAUGCCUGGUAA GUCGUCGUCUGAUACUAA3 rII A. The following double mutants are made. For each double mutant write out the sequence of the rll protein it will make. Predict (circle) whether the phage will be rl+ or rll Double mutant or rI UCGUCGUCUGALIACUAA3 Nostart codon, no protein 2, 3 NetArgcystysvalvalvAl 2,14 5 UUAUGCGCUGGIUAMG UCGUCGUCUGALIACUAA3 MetArgTrP B. You isolate an E. coli strain that contains a mutation in a tRNA gene.The normal antiend fnr this tRNA is 3' GCII 5', the mi ated tRNA hr the Anticndon ACII 5 This change in the anticodon does not affect the amino acid that attaches to the tRNA. You infect this strain with wild type T4 and then look to see if an abnormal form of the rli protein is made. If an abnormal form is made, what is its amino acid sequence. Met ProGlyLys Tyr

Explanation / Answer

The normal anti codon for the tRNA is 3' GCU 5', which binds to 5' UGA 3' on the mRNA. This is a Stop codon.

For the mutated tRNA, anticodon 3'ACU 5' binds to 5' CGA 3' on the mRNA. This codes for the amino acid Arg.

Since the stop codon after Val is no longer there, binding of tRNA does not stop. The next tRNA (3' AUG 5') binds to 5' UAC 3' on the mRNA. This codes for the amino acid Tyr.