Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Creation of target construct According to the article \"High-level expression of

ID: 175113 • Letter: C

Question

Creation of target construct

According to the article "High-level expression of bioactive recombinant human lysozyme in the milk of transgenic mice using a modified human lactoferrin BAC" by Shen Liu

The 4.8-kb hLZ genomic sequence, starting from the ATG start codon to the TAA stop codon and flanked by two homology arms, was obtained by PCR using the BAC clone RP11-1143G9 (Genome Systems Inc., St. Louis, Mo.) as a template and using the following primers: hLF-hLZ-F (5-CTAGCTAGCAAAGCCCTGAATAAAGGGGCGCAGGGCAGGCGCAAGTGGCAGAGCCTTCGTTTGCCAAGTCGCCTCCAGACCGCAGACATGAAGGCTCTCATTGTTCTG-3) and hLF-hLZ-R (5-CTAGCTAGCAGGGGAGGCCAAGGCCCCAACACACCTGGGGAGAAGAGCTGGGGG CAGTGAATGGCTGAGGCTTTCTTGGGGAGCTGGGCCATCTTCTTCGGTTTTACACTCC ACAACCTTGAAC-3), where homology arms to the hLF gene are in bold, and NheI restriction sites are in italics. The PCR product was cloned into the pMD19-T cloning vector (Takara, Dalian, China) and confirmed by sequencing. A zeocin (Zeo) cassette flanked by two FRT sites for positive selection was blunt-end ligated into the HpaI site in intron 2 of the hLZ gene. The resulting targeting construct, named pMD19-hLZ-Zeo, was linearized with NheI, and the DNA fragments containing hLZ-Zeo were purified for recombineering.

In the Supplementary Materials and Methods under “Creation of targeting construct for recombineering” are listed two very long PCR primers called hLF-hLZ-F and hLF-hLZ-R. Describe the target that is used by these primers in their PCR

Explanation / Answer

Hlf is lysozyme & hlz is lectoferin..both are expressed in mammery gland.lysozyme is a antibacterial enzyme.& lactoferin is a milk protein.