Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

6. Below are three promoters which correspond to three versions of a gene that c

ID: 182253 • Letter: 6

Question

6. Below are three promoters which correspond to three versions of a gene that contains a TATA box in its promoter. One of them is a pseudogene. Which one? Please explain your logic briefly. X1: 5'-AAGACTTGCTTTGAGAATGTAATGGCCCATATTATAAAAAGTACGTGACTG X2: 5'-AAGACTTGCTTTGAGAATGTAATGGCCCATATTATAGATAGTACGTGACTG X3: 5'-AAGACTTGCTTTGAGAATGTAATGGCCCATATTATATAAGGTACGTGACTG The consensus sequence for the specific transcription factor API FJ is. 5'- ccTGACatttg -3' The top strand of the promoter region of 3 genes (A, B and C) are shown below with the transcription start site (arrow). To which promoter will AP1FJ bind to? Please underline the sequence and explain why you think it will bind to that sequence. 7· A: 5'-AAGACTTGCTTTGAGAATGTAATGGCCCTGACATTTGGTGACTGACGTACGTGACTG B: 5'-AAGGCCGTTACCTAAACCCGTGTATGAGAATGACATTGCGCGTGACTCCGGAACCAT C: 5'-AAATGACTTGGTTATTATATAATGGCTCCTGAGATTTGCGTGACGACTGTACTTACGA

Explanation / Answer

X1 is a pseudogene. Pseudogenes often result from the accumulation of multiple mutations within a gene whose product is not required for the survival of the organism, but can also be caused by genomic copy number variation (CNV) where segments of 1+ kb are duplicated or deleted.

TAAAAAG part of this gene cannot transcribe any functional amino acid.