1. Huntington disease (HD) is an inherited neurodegenerative disorder, character
ID: 188689 • Letter: 1
Question
1. Huntington disease (HD) is an inherited neurodegenerative disorder, characterized by the gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age. The course of the disease can last 15 to 20 years. The molecular basis of the disease is becoming better understood. The genetic mutation underlying HD has been traced to a gene encoding a protein (M 350,000) of unknown function. In individuals who will not develop HD, a region of the gene that encodes the amino terminus of the protein has a sequence of CAG codons (for glutamine) that is repeated 6 to 39 times in succession. In individuals with adult-onset HD, this codon is typically repeated 40 to 55 times. In individuals with childhood-onset HD, this codon is repeated more than 70 times. The length of this simple tri-nucleotide repeat indicates whether an individual will develop HD, and at approximately what age the first symptoms will occur A small portion of the amino-terminal coding sequence of the 3,143-codon HD gene is given below. The nucleotide sequence of the DNA is shown, with the amino acid sequence corresponding to the gene below it, and the CAG repeat is shaded. Translate the genetic code and outline a PCR-based test for HD that could be carried out using a blood sample. Assume the PCR primer must be 25 nucleotides long. By convention, unless otherwise specified a DNA sequence encoding a protein is displayed with the coding strand (the sequence identical to the mRNA transcribed from the gene) on top such that it is read 5' to 3', left to right. a. 307 A GTCCTTC 358 18 QF QQ Q Q Q Q Q Q Q 409 35 QQ P PP P P PP P 460 CCGCCTCCTCAGCTTCCTCAGCCGCCGCCGExplanation / Answer
Te primers are short complimetary sequences that bind to the DNA segment to be amplified and serve as a platform for the DNA polymersse. The Primer sequence will be TACCGCTGGGACCTTTTCGACTACTT