1. How did the experiment with the smooth and rough bacteria help us understand
ID: 188812 • Letter: 1
Question
1. How did the experiment with the smooth and rough bacteria help us understand the basis of inherited information.
A. It demonstrated that a characteristic (ability to cause disease) was a trait that could be passed from dead cells to living cells
B. It demonstrated that a characteristic (ability to cause disease) could only be transferred between living cells.
C. It demonstrated that a characteristic (ability to cause disease) could only be acquired by cells that were once dead and then reincarnated.
D. It demonstrated nothing of significance.
2. What was the siginificant contribution of the Hershey and Chase experiments to our understanding about the basis of genetic information?
A. DNA is only found in viruses and not any cells.
B. The genetic information that was transferred from the viruses to the cells was DNA and not protein.
C. The genetic information that was transferred from the viruses to the cells was protein and not DNA.
D. Viruses are the basis for all genetic information.
3. If one strand of DNA has the following sequence, what is the corresponding complementary strand?
ATCGCGATGCTGCTCTAATTAATT
TAGCGCTACGACGAGATTAATTAA
ATCGCGATGCTGCTCTAATTAATT
UAGCGCUACGACGAGAUUAAUUAA
ATCGATCGATCGATCGATCGATCG
A. It demonstrated that a characteristic (ability to cause disease) was a trait that could be passed from dead cells to living cells
B. It demonstrated that a characteristic (ability to cause disease) could only be transferred between living cells.
C. It demonstrated that a characteristic (ability to cause disease) could only be acquired by cells that were once dead and then reincarnated.
D. It demonstrated nothing of significance.
2. What was the siginificant contribution of the Hershey and Chase experiments to our understanding about the basis of genetic information?
A. DNA is only found in viruses and not any cells.
B. The genetic information that was transferred from the viruses to the cells was DNA and not protein.
C. The genetic information that was transferred from the viruses to the cells was protein and not DNA.
D. Viruses are the basis for all genetic information.
3. If one strand of DNA has the following sequence, what is the corresponding complementary strand?
ATCGCGATGCTGCTCTAATTAATT
A.TAGCGCTACGACGAGATTAATTAA
B.ATCGCGATGCTGCTCTAATTAATT
C.UAGCGCUACGACGAGAUUAAUUAA
D.ATCGATCGATCGATCGATCGATCG
Explanation / Answer
How did the experiment with the smooth and rough bacteria help us understand the basis of inherited information.
It demonstrated that a characteristic ability to cause disease was a trait that couldb be passed from dead cells to living cells.
What was the significant contribution of Harshest and chase experiments to our understanding about the basis of genetic information ?
The genetic information that was transferred from the viruses to the cells was DNA and not Protein.
If one strand of DNA has the following sequence what is the corresponding complementary strand?
TAGCGCYACGACGAGATTAATTAA