Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

16. You digested a linear DNA fragment with a RE and the fragment has three reco

ID: 191970 • Letter: 1

Question

16. You digested a linear DNA fragment with a RE and the fragment has three recognition sites for the RE. How many fragments of DNA will be produced?

A. three               

B. four

C. five

D. six

                   

17. The RE HhaI cuts the recognition site 5’GCGC3’. The probability of having a cutting site for this enzyme is about one in every __________bp of genomic DNA.

A. 100

B. 250               

C. 1000

D. 10,000

                   

18. The RE HinD III recognizes/cuts the site 5’AAGCTT3’. If you cut a 100,000 bp DNA fragment with the enzyme, you expect about _________ DNA fragments.

A. 15

B. 25                   

C. 35

D. 45

                   

19. Methylation-sensitive REs _________.

A. do not cut DNA if the recognition site is methylated

B. cuts DNA only if the recognition site is methylated

C. shows more star activity than typical REs

D. lacks any isochizomers

20. DNA ligation is __________ (only the most appropriate answer will be scored) A. cross-linking two molecules of DNA

B. cutting DNA (severing a phosphodiester bond)

C. linking two DNA molecules by any given bonds           

D. attaching two DNA molecules by restoring the phosphodiester bonds

                   

21. RFLP is often used in human identification through DNA finger printing. RFLP is largely based on ___________.

A. mutation in the RE cutting sites

B. sequence-specificity of the type II REs               

C. mutation of the genomic DNA in general

D. mutations in the RE recognition/cutting site and sequence-specificity of REs

                   

22. RFLP pattern of the GAPDH gene of two siblings appeared different but both are healthy and well. It is most likely because ______.

A. The restriction enzyme used cuts DNA of different individual at different cut sites

B. One of the siblings has a mutation in the gene               

C. The GAPDH gene is polymorphic

                                   

23. You need to separate ssDNA molecules that are different from each other by one or a few nucleotides in size. You should use________ gel.

A. 1-2% native agarose

B. 2-3 denaturing agarose           

C. 3-4% native polyacrylamide

D. 5-6% denaturing polyacrylamide

                   

24. The electrolyte used in electrophoresis contains _______, the stains used in visualizing nucleic acids include _______ and the denaturants used in denaturing gel electrophoresis generally include _______.

A. NaCl/ methylene blue/ Clorox

B. Tris acetate/ ethidium bromide/ urea or formaldehyde               

C. Tris borate/ acrydine orange/ sodium hydroxide or ammonia

                    

25. DNA (or RNA) molecules are generally radiolabeled by using an isotope that is a component of the ____________and the common isotopes used are ________.

A. bases/14-C and 15-N

B. phosphates/ 32-P and 17-N               

C. pentose sugar/ 14-C and 15-O

D. bases or phosphates/32-P and 3-H

26. You want to test if new DNA has been synthesized in cells treated with a drug, you would grow the cell in the presence of 32P-labeled ________.

A. ATP

B. dGTP       

C. CTP

D. dTTP

E. UTP

                   

27. Your probe is labeled with biotin; you should trace the probe using ________.

A. X-ray films

B. streptavidin

C. a fluorescent microscope           

D. a beta or optical scanner E. enzyme-linked antibodies

                   

28. Fluorescent dyes can be attached to large fragments of DNA by any of these methods except ______.

A. attaching the dye to oligonucleotides and then using the oligonucleotides for DNA synthesis (by PCR)

B. labeling the bases of the nucleotides with the dye and using the nucleotides to synthesize DNA

C. inserting the free dyes into a cell and having the cell incorporate the dye in its DNA

                   

29. You cut a piece of DNA with EcoRI and want to end-label the DNA with 32P. You would use nucleotides labeled at the _______ and the enzyme __________ to complete the job.

A. beta phosphate/ polynucleotide kinase (PNK)

B. alpha phosphate/DNA polymerase           

C. gamma phosphate/ DNA ligase

D. any of these/ any of these

                   

30. The molecule 5’CCCCAUUGAUGGCGAAUUGC3’ is attached to a membrane. The membrane is a _____________.

A. Southern blot

B. Northern blot           

C. Western blot

D. Northern or southwestern blot

Explanation / Answer

1) Four - When a linear DNA is cut at three sites with a restriction enzyme, there will be four fragments of DNA. Whereas in a circular DNA only three fragment can be cut with three restriction sites.