Need help answering question i. ii iiiiv from the first example and questions fo
ID: 192165 • Letter: N
Question
Need help answering question
i.
ii
iiiiv
from the first example and questions form the second example
a
b
c
Two different examples of cloning into a vector. which restrictin enzymes are best to use to insert the entire gene to the vector and why?
Please explain! Thanks
Interpretation Questions 4: Cloning and Sequencing 1. In the lab you are investigating a DNA polymerase. Your advisor provides you with a dsDNA fragment that contains the polymerase open reading frame (ORF). Below is a diagram showing only the sense (coding) strand of this fragment with the first and last 12 bases in the polymerase ORF and the flanking sequence Start codon Stop codorn 5AAACTGAAGGAGGATCCAGGAAGCTT ATGGGAACCGGGAGATCTTACTAA TAGATCTAAGTACT...3 Bam Hindlll Bgl Bgl Scal Polymerase ORF To express the polymerase with a N-terminal 6x His-tag you decide to excise the ORF from the dsDNA fragment above and insert it into the expression vector pET702 below. The sense (coding) strand (shown 5 to 3') of the cloning region of pET702 is shown below (the sense strand sequence of the restriction enzyme recognition sites in the MCS are underlined). T7 promoter Lac operator codon rbs TITAGTAAGGAGATATACATTTGGCTAGCATCACTGGTGGACAGCAATCAT His-tag AAAAGCITTAGATCTGGCGGATCCGAAACGCTTTGGGATATCAAACTCCAGAACAGTCAAATTTTGTTGC Hindl BBamHI EcoRV 17 terninator EcoRV GAT ATC35A GATC T3 Hindlll Scat Note: 1) shows the position of the cut sites. 2) The restriction enzyme sites shown in the DNA fragment and plasmid occur nowhere else in the fragment or plasmid. Using only the restriction enzymes listed above design a cloning strategy that will allow you to insert the polymerase ORF into pET702 for expression of the entire ORF with a N-terminal 6x His-tag. Your answer only needs to include the following:Explanation / Answer
1) i) ii an iii) I would generally choose BamHI and ScaI, However ScaI is not present in vector so other option will be BglII. I did not choose HindIII even though it is present on vector because the use of this enzyme will cause frameshift as just after ending of His tag there is only two nucleotide AA and we know that codon is made of 3 nucleotides therefore uses of HindIII will alter the entire amino acid chain of the gene of interest.
so I will digest my gene of interest and vector with BamHI and BglII restriction enzyme
iv) there is one potential problem with this cloning strategy that BglII site is also present within the ORF of our gene of interest which may cause truncation of one codon from the 3' end of our gene of interest.
2) a) b) and c) given sequence will bind to the antisense strand of lac operator region. Therefore, using this primer we can determine the sense strand