1. Consider the following RNA, transcribed from the complementary DNA. The RNA c
ID: 193829 • Letter: 1
Question
1. Consider the following RNA, transcribed from the complementary DNA. The RNA contains introns and exons. The exons are in uppercase, introns are in lowercase. After splicing, what will the sequence of the RNA be? 2. Explain the method of GFP fusion genes in your own words (see video 5b!) 3. For the following methods, do we study expression at the RNA or protein level? In situ hybridization: PTOrenIover Western blot You are studying a species of lizard that has no external genitalia or clear differences between sexes, but which is known to have X/Y sex determination. Would you guess that the individuals below are male or female? Individual A? Individual B?Explanation / Answer
1.AUCACAAACUAGAUGGUACCAGAUAAUAUUAGG will be the the ligated 2 exons sequence after splicing ,which will then translated to protein.
The interon sequence will be discarded out by spliciosome machinery the sequncese of intron will be GUGACAGUAACAGUAGUAGUGAAGUAG . ultimately it will be degraded after release from spliciosome
2. Green fluorescent protein is generally obtained from jelly fish .
GFP protein has an internal ability of fluorescence . Due to this GFP is utilized in localization of protein in the cells in vivo. GFP IS first tagged with Gene of interest and then expressed in cell and the protein is localized by it fluresence emmited in green light recorded .
GFP and other fluorescent proteins are utilize in FRET to identify interactions between the protein .GFP are also used in tracking movement of membrane protein in the membrane.
3. Expression of protein can be studied using western blot technique if we have antibodies which recognise our gene of interest. Insitu hybridization cant be used in case of protein expression ,insitu can be used for identification of genes in cell offer fixing by supplying prob (which have complementryity to our gene of interest) with radiolable or fluorescent tag or antibody based.so protein cant be identified by insitu hybridization.
4 In reptiles case , precisely in lizards sex dermination is both temperature dependent and genotypic dependent .
Genotypic sex determination (GSD) depend on xx(female) and xy (male) sex chromosome but it has been observed that temperature changes can over ride the GSD as if temperature in the nest having eggs fall then even with xx egg will give rise male offspring .
Reptile have total 64 chromosome including 2 sex chromosomes (XX/XY).
Individual A will be male because it has X and Y chromosome given in karyotype map. Y chromosome is of short arm usually.
Indivisual B have 2 X chromosomes will be female.