The picture shown below is a sequence alignment of an entire gene\'s DNA sequenc
ID: 197607 • Letter: T
Question
The picture shown below is a sequence alignment of an entire gene's DNA sequence and the entire sequence of the mRNA produced from that gene. The top line is the DNA and the bottom line is the mRNA. Each nucleotide in the gene is numbered. Vertical dashes indicate nucleotides that are identical in both sequences. Dots indicate nucleotides in the DNA sequence that are not found in the mRNA sequence. @ represents a 5-G-cap. AGCGAACAAACAACCTAACATC GGATTGCAGGACCGCGGGGCAGGATTGC 50DNA mRNA TCCGGGCTGTTTCATGAC TA 100 DNA =mRNA GAAGGTCATGGGGTGGCCAACTTGGGCGAGAAAAGGTATATAAAGGTCTC 150 = DNA = mRNA TTGCTCCCATCAACTGCCTCAAAAGTAGGTATTCCAGCAGATCAGACAAC 200 = DNA = mRNA CAAACAAACACACTTCATTCCCAAGACATCACTCACAAACAACCAACCTC 250 = DNA IITTIIITTIExplanation / Answer
the answers are mentioned below
A) it is a coding strand. it is similar to the mRNA sequence other than the fact that thymine is replaced by uracil. if it was a template strand, it would be complementary to mRNA.
B) 204
C)675
D) 465, start codon AUG
E) 675, stop codon UGA
F) 2 INTRON
G)I1 - 1-204, I2 - 354-465
H) 2 exons
I) aminoacid = 675-465=210 nucleotide, 210/3=70 aminoacid
J)5' UTR - 254-403
K)3' UTR - 675-694