Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

a. (1pts) How many base pairs would in the final mRNA? Show your work b. (Ipts)

ID: 197785 • Letter: A

Question

a. (1pts) How many base pairs would in the final mRNA? Show your work b. (Ipts) How many bases were spliced out? Show your work 33,0es-10 7) Answer the following questions about the Ribosome pictured below. a) (1pts) What is the region of the mRNA with all of the X's in this image called? a) (2pts) Describe the next two steps that occur within this UACGCG xx xXxXAUGCGCGGAUCCCCCACCUGA LILLLLLELILLELLLLLLLLLLLLLLribosome. codon 1 codon 2 b) (2pts) In the space below draw the next TWO CHARGED-IRNA's that you would expect to see interacting with this ribosome- be sure to include their Anticodons.

Explanation / Answer

7a)It is the region of polyadenylation. 5' end of mRNA undergoes adenylation to avoid enzymatic digestion.

b)elongation and termination