Please help me understand this portion of my Part 2. Mutations The nonpurple all
ID: 199132 • Letter: P
Question
Please help me understand this portion of my Part 2. Mutations The nonpurple allele of anthocyaninless that you worked with product. However, there are many possible mutations that can inactivate a some sequence from the first exon of the anthocyaninless gene with the start is an insertion mutation that causes the you worked wi codon underlined. Mark one base substitution that Explain below the sequence why you think it would cause a nonpurple allele. ACAAAGATGGTAGCTCACAAAGAGACCGTGTGCGTAACCGGCGCATCAGGATTCATTGGTTCATGGCTC you predict would also cause a nonpurple allele. Mark one base substitution that you predict would not affect the gene's function. In other words it would still be a purple allele even though there was a sequence changes. Explain below the sequence why you think it would not change the gene's function. ACAAAGATGGTAGCTCACAAAGAGACCGTGTGCGTAACCGGcGCATCAGGATTCATTGGTTCATGGCTOExplanation / Answer
Anthocyanin is a flavonoid pigment which gives purple colour in the stem and leaves of various plant species. Production of this specific metabolite is under genetic control. Non-expression of the underlying gene fails to produce purple colour in the plant. The trait, Non-purple (Anthocyaninless) can be induced by mutation.
A given base sequence of DNA strand codes for specific polypeptide sequence, and that is responsible for expression of traits in form of various metabolites. Mutation (A sudden change in nucleotide sequence, either at one base or multiple) can lead to production of abnormal or non-functional protein, thus altering the underlying trait.
Change in Nucleotide base at a single base position is known as Point Mutation. It may be due to ADDITION of a base, Deletion of a base or SUBSTITUTION of base at one base position. First two conditions changes the Popypeptide sequence by altering the Reading Frame of the codons, thus, coding for a new set of amino acids. Codons are arranged in triplet coding for a specific Amino Acid. Substitution does not change reading frame but it alters the amino acid that has to be coded.
Codons are specific (one codon codes for a specific amino acid) , but they are DEGENERATE (one amino acid can be coded by more than one codons). So, a substitution that will cause the codon to code for a different amino acid will lead to production of different set, translating into a non-functional protein; ( Missense Mutation) .
A base substitution, which does not alter the underlying sequence of amino acid, will lead to production of a normal, functional protein; (Silent Mutation).
In first case, we have to mark a Missense Mutation.
ATG GTA GCT CAC AAA GAG ACC GTG TGC GTA ACC GGC GCA TCA GGA TTC ATT GGT TCA TGG CTC
(I have just mentioned from start codon, as translation of codes into amino acids start from here only)
There are 21 sets of codon coding for
Met- val-ala-his-lys-glu-thr-val-cys-val-thr-gly-ala-ser-gly-phe-Ile-gly-ser-trp-leu
Any change in this base sequence will lead to production of non-functional pigment.
In the codon TTC, substitution of C with G will lead to formation of a new combination TTG, which will code for Leu instead of phe, which is an important amino acid for biosynthesis of anthocyanin.
In second case, we have to look for a silent mutation. In that codon for Phe, substitution of C with T will lead to a new codon TTT, which will code for Phe as the original sequence. so, although having a base substitution , as amino acid sequence is not changing, so purple colour will be seen.