Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Long answer -provide as much mechanistic detail as possible in drawings and anno

ID: 200123 • Letter: L

Question

Long answer -provide as much mechanistic detail as possible in drawings and annotations. Please do not write answers in paragraph form. 1. Using the signaling proteins and the domain descriptions below, indicate the order in which a set of these proteins will function in a signaling pathway to activate transcription of a gene regulated by the promoter shown below. Begin with extracellular ligand activation of a receptor tyrosine kinase dimer. For example, begin by writing, "Protein 1 binds protein X and protein X, .". Alternatively, you may simply draw the signaling pathway. You have been provided enough room to sketch out multiple attempts before providing the final answer. Please note that you are not required to use all of the proteins. (30 points) Domain Descriptions Signaling Proteins Protein 1 L Ligand TKD tyrosine kinase domain, and phosphorylates only the YonY motif S/TK A - serine/threonine kinase domain A, and phosphorylates only the XSXRXS motif Protein 2 bHLH ASQ S/TK B serine/threonine kinase domain B, and phosphorylates only the XSXRXXS motif PH PH domain TM transmembrane domain LBD ligand binding domain SH3·SH3 domain SH2 SH2 domain PTB phosphotyrosine binding domain PRR proline rich region bHLH basic helix-loop-helix domain and binds only 5'-GATAACA-3 SH2 PH PH SH2 Protein 3 bHLH ASQ Protein 4 ZF ASQ Protein 5 ZF ASO Protein 6 PRR S/TKA YAPYAY Protein 7 PRR STKA YAYPY Protein 8 TKD YAPYAYTM LBD Protein 9 TKD YAPYAY TM LBD Protein 10 TKD YAPYAY PH LBD Protein 11 TKD YAPYAY PH LBD ZF- zinc finger and binds only 3-TTTATC-5 Gene Promoter Region Protein 12 SITK B ASQRAS PTB Protein 13 TKD ASQRAS SH2 Protein 14 5' GTGCTAGCACTATTGTGGCCTGAGCTGAACTAGTGCAAGCA 3 SH3

Explanation / Answer

Because protiens , rather all amino acids forms peptide bond. There are also

Bonds like vanderwals force, salt bridge , weak hydrogen bond ,

Which helps to combine the protiens with each other .