Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

You are doing a rotation in a lab in Neither City. A colleague has sent you a pl

ID: 200894 • Letter: Y

Question

You are doing a rotation in a lab in Neither City. A colleague has sent you a plasmid vector construct containing the gene for smartase isolated from unicorn. To confirm the DNA sequence you use the Sanger method. Below is a part of your sequencing results (the method is described on p718 of your book) ACGT 1. (3pts) What is the sequence of those first 20 nucleotides? A. CTGCTGATGTTGAATTAGAG B. ACTGCTGATGTTGAATTAGA C. ACGTAGGTACGATCGATGT D. GACTAGTGCTCCTGGCCGTG 2. (3pts) Assuming the strand that you just read is the coding strand, what is the complementary DNA sequence? A. 3' ACTGCTGATGTTGAATTAGA5 B. 3' ACUGCUGAUGUUGAAUUAGA5 C. 3' UGACGACUACAACUUAAUCU5' D. 3' TGACGACTACAACTTAATCT5'

Explanation / Answer

1-B

2- D

3-B

4-A

Note-the dna coding strand has bases complimentary to non coding strand . Base A pair with T and C with G and vice versa . The mrna formed ovr template strand has bases similar to coding strand except uracil in plac of thymine. These bases as triplet provide codon to be read as a amino acid forming chain.