Unsure of what the 3rd question is. I was told that I should include the nucleot
ID: 201387 • Letter: U
Question
Unsure of what the 3rd question is. I was told that I should include the nucleotide before the AUG codon and after the UAG codon (5' GCC AUG UAC... UAG GGG 3') is that right? Or
should I take out those nucleotides in a mature mRNA? Something like this then (5' AUG UAC ... UAG 3')
NAME: Topic: Central Dogma 5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All.ef the written sequences on the template strand are transcribed into RNA 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? c. What is the sequence of the nucleotides in the processed (mature) mRNA molecule for this gene? Indicate the 5' and 3' polarity of this mRNAExplanation / Answer
A answer is 5' CCCCTAT...........GGC 3' will be template strand.
B answer is RNA polymerase will move from its 5' to 3' direction i.e left to right of template strand.
C answer is 5' CCCCUAUGCCCCCCUGGGGGAGGAUCAAAACACUUACCUGUACAUGGC 3'