First hird Third-Base Degeneracy ls Color Coded Third Bases Third-Base with Same
ID: 206350 • Letter: F
Question
First hird Third-Base Degeneracy ls Color Coded Third Bases Third-Base with Same Number of Relationship Meaning Codons s'end) end UUU Phe UCU Ser UAU Ty UGUOsThird base U,CAG $2 (8 familie Purises AorG 12(6pairs) Three out U,C,A 3(AUX lle) CUA Leu CCA Pro CAA Gn CGA ArgA Unique Aonly 100A-Sop) GUAVl CA la GAA Glu GAGA GuGVal ccG Ala AUG signals translation inttion aswell as coding for Met residues Using the genetic code provided, identify the amino acid sequence (using 1- or 3-letter codes) of the peptide encoded by the template DNA sequence shown below. 5'-TG CTACGAGATCGCTT GGTCGGACAT TATCG-3"Explanation / Answer
3' ACGATGCTCTAGCGAACCAGCCTGTAATAGC 5' is the complementary starnd.
The mRNA strand would be same just replace t with u
ACG AUG CUC UAG CGA ACC AGC CUG UAA UAG C(I've written it with spaces just for convenience of identifying codons )
You have to start at AUG since that is the start condon
Amino acid sequence : Met-Leu
next codon is UAG and that is a stop codon you have to stop .