Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Answer the following questions: Note: Met (the first amino acid) should always b

ID: 208665 • Letter: A

Question

Answer the following questions: Note: Met (the first amino acid) should always be included in the total number of the amino acids of every polypeptie.

. 5- Which mutant allele(s) produce(s) an identical polypeptide as the normal one? Just type the name(s).

6- Which allele(s) produce(s) the longest polypeptide? Just type the name(s).

7- Which polypeptide(s) have (has) a “Ala” in position 11? Just type the name(s).

ASSIGNMENT GUIDE: 1- Express the wild allele (M1, typed below, go through all of the steps of gene expression), and write down the normal product (P1). 2- Note that the promoter of the gene is on the right side of the gene! 3- Apply all of the changes (from # II to # VI, one at a time) on the original wild allele. Each change (mutation) results in generation of a new mutant allele (M2 to M6). 4- Express all of the new alleles (M2 to M6, one by one) to come up with a product for each one (P2 to P6 for the mutant products). 1 3’GCTATATAGGAAGATTAAATAATACAGTAAACGGGCGAGTCTACAAACCGTACTAAATAATGTTACAAAGTATATTTGGCCGATATATCC 5’

5’CGATATATCCT TCTAATTTATTATGTCAT TTGCCC GCTCAGATGTTTGGCATGATTTATTACAATGTTTCATATAAACCGGCTATATAGG 3’

Note: The promoter is at the right side, and the terminator is at the left side of the gene. I- Assume that the sequence above is the normal (wild) allele for gene M (let’s call it allele M1). The normal allele M1 encodes polypeptide P1. II- If base pair G/C is added between positions 35 and 36 of gene M (to allele M1), allele M2 is produced, which encodes polypeptide P2. G is added to the top strand. III- If base pair C/G is inserted between positions 60 and 61 of gene M (into allele M1), allele M3 is produced, which encodes polypeptide P3. C is added to the top strand. IV- If base pair number 53 (in allele M1) is changed from C/G to A/T, allele M4 is produced, which encodes polypeptide P4. V- If base pair A/T is inserted between nucleotides 40 and 41 (into allele M1), allele M5 is produced, which encodes polypeptide P5. A is added to the top strand. VI- If base pair number 64 (in allele M1) is changed from T/A to C/G, allele M6 is produced, which encodes polypeptide P6.

Explanation / Answer

Q5.

Ans:- M2, The Mutant allele is starting from M2.Hence the first mutation will be from M2.

Q6.

Ans:- M6,allele M6 is produced longest polypeptide coz after the insertion (mutation) A/T TO G/C..

Q7.

Ans:- P6

   Ala codes by GCU,GCC,GCA,GCG