a. Propose a complementary antisense RNA that would interact (hybridize) with Ta
ID: 210951 • Letter: A
Question
a. Propose a complementary antisense RNA that would interact (hybridize) with Tazswana’s pre-mRNA. Draw the 10 nt DNA oligonucleotide that would complementary base-pair with the premRNA to specifically “mask” the extra 5’ splice site (underlined). Be sure not to mask the normal splice sites! Assume her intron sequence for the abnormal pre-mRNA is as shown here: 5’ GUAGUCCAGGGAUGCAGAAGAAGGUGGACCCUUAUCCAG 3’
b. Describe what would happen once the antisense RNA was delivered into Tazswana’s cells.
c. Discuss the type of cell the antisense RNA would need to be delivered to in order to affect alternative splicing of the beta-globin pre-mRNA.
d. Describe whether or not you believe the antisense therapy would have adverse side effects and explain why.
Explanation / Answer
A.
Sense strand: 5’ GUAGUCCAGGGAUGCAGAAGAAGGUGGACCCUUAUCCAG 3’
Antisense : 3' CAUCAGGUCC 5'
B. Mechanistically, antisense RNA hybridizes to the sense RNA strand and creates a translationally inactive double stranded RNA molecule. Formation of dsRNA molecule silences gene expression through cooperative action of one or more intermolecular mechanisms.
C. Mouse myoblasts and myotubes is the cell type where the antisense RNA need to be delivered to affect the beta globin pre-mRNA
D. Yes, antisense therapy would have side effects as the antisense RNA would have off-target effects which would lead to various serious consequences.