Gene X of Bacteriophage UCLA is required for generating small plaques on a lawn
ID: 211870 • Letter: G
Question
Gene X of Bacteriophage UCLA is required for generating small plaques on a lawn of E. coli. Gene X mutants make a large plaque. The entire mRNA sequence of a wild type Gene X is shown below. It is known that as long as the amino acid sequence CYS-LEU-GLU of the protein is expressed, the phage is able to generate small plaques. Any alteration to the expression of these three amino acids results in a mutant phage that makes large plaques.
You isolated two nonsense mutations in this gene, both of which generate large plaques on E. coli. Their mRNA sequences are indicated below (the mutated base is in bold and underlined). WT Mut#1 GAUACAUGUGUUAGGUGCUGUGCCUAGAGAAAUUUACCUGAGUCAAAAA Mut#2 GAUACAUGUGUCAGGUGCUGUGCCUAUAGAAAUUUACCUGAGUCAAAAA GAUACAUGUGUCAGGUGCUGUGCCUAGAGAAAUUUACCUGAGUCAAAAA C. Describe a tRNA suppressor mutation that will suppress both Mut#1 and Mut#2. For your answer fill in the 3-base sequence of the anticodon region of the wild type tRNA and the mutated suppressor tRNA. Assume that the mutation changing the anticodon sequence has no effect on the amino acid the tRNA is charged with. (There may be more than one correct answer, only one is required) Wild type tRNA anticodon sequence: 5 3' Suppressor tRNA anticodon sequence: 5' 3'Explanation / Answer
C) Wild type tRNA anticodon sequence: 5’ CUC 3’ __ 5’ UUC 3’
Suppressor tRNA anticodon sequence: 5’ CUA 3’