Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The sequence is: TACAAACGCTTGTGCCGCAGGTGCTATACAATC Change either the first of se

ID: 21374 • Letter: T

Question

The sequence is: TACAAACGCTTGTGCCGCAGGTGCTATACAATC

Change either the first of second base of any triplet in this sequence other than the start or stop codon and write the nucleic acid sequence from transcription?

What happens to the amino acid sequence in translation?

Thanks a bunch!

Explanation / Answer

DNA = TAC---AAA-CGC-TTG-TGC-CGC-AGG-TGC-TAT-ACA---ATC RNA = AUG---UUU-GCG-AAC-ACG-GCG-UCC-ACG-AUA-UGU---UAG 1 2 3 4 5 6 7 8 9 10 11 AA = START---phe-ala-asn-thr-ala-ser-thr-ile-cys---STOP Suppose we change the second base of the 7th triplet from G to A. It becomes AAG -> UUC or "phe" instead of AGG -> UCC or "ser". The sequence becomes: DNA = TAC---AAA-CGC-TTG-TGC-CGC-AAG-TGC-TAT-ACA---ATC RNA = AUG---UUU-GCG-AAC-ACG-GCG-UUC-ACG-AUA-UGU---UAG 1 2 3 4 5 6 7 8 9 10 11 AA = START---phe-ala-asn-thr-ala-phe-thr-ile-cys---STOP