Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Shown below is a portion of a wild-type DNA sequence that encodes the last amino

ID: 214909 • Letter: S

Question

Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region.

                  5’-GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG-3’
                 3’-CGA
TTCATAACGAGTTCTAATCCTACTATTTATTGACC -5’

A. Which strand is the template strand for transcription of this gene? Briefly explain how you know.

B. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur?

C. A change of one base pair leads to the protein increasing in length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair to for the protein to increase in length by one amino acid?

Explanation / Answer

ANSWER A.
The bottom strand, i.e., the
3’-CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC -5’ strand is the template strand for the transcription of this gene. This is because the Transcription machinery makes RNA in the 5' to 3' direction only because of the directionality of the condensation reaction which requires a free OH -group for the incoming molecule.

ANSWER B.
This Template DNA
3’-CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC -5’
would have given this mRNA 5' -
GCUAAGUAUUGCUCAAGAUUAGGAUGAUAAAUAACUGG - 3'
which translates into this protein AKYCSRLG..IT (where the dots (..) indicate stop codons)
To obtain 7 less amino acids the KYCSRLG section in AKYCSRLG in needs to be removed for which the codon expressing K needs to turn into a stop codon. The K is encoded by AAG, which can be made into a UAG that is a stop codon. Hence, the change in the template DNA to accommodate this should be:
3’-CGAATCATAACGAGTTCTAATCCTACTATTTATTGACC -5’

ANSWER C.
This Template DNA
3’-CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC -5’
would have given this mRNA 5' -
GCUAAGUAUUGCUCAAGAUUAGGAUGAUAAAUAACUGG - 3'
which translates into this protein AKYCSRLG..IT (where the dots (..) indicate stop codons)
To obtain 1 more amino acid the first dot (.) stop codon section in AKYCSRLG..IT needs to be changed into a non-stop codon.The stop codon is encoded by UGA, which can be made into a GGA that is a codon for Glycine. Hence, the change in the template DNA to accommodate this should be:
3’-CGAATCATAACGAGTTCTAATCCTCCTATTTATTGACC -5’