Given the DNA sequence below, if read from left to right by RNA polymerase, what
ID: 215561 • Letter: G
Question
Given the DNA sequence below, if read from left to right by RNA polymerase, what RNA would RNA polymerase synthesize? Please write your RNA in the 5'-3' direction and include ONLY letters (do not include the 3' or 5')
5-ATGCCCTTTCGAAGCTATGGGTAA
3-TACGGGAAAGCTTCGATACCCATT
The ribosome now will read the correct RNA from question #1 to make a protein. Please write the one letter amino acid code below (see table 2.2 on page 32 of your textbook). If you have a stop codon then please indicate the stop codon with a "-". An example of an answer with a stop codon would be "MTKEVLR-"
Explanation / Answer
1. RNA polymerase synthesizes mRNA
The RNA is 5'-3' direction will be :
AUGCCCUUUCGAAGCUAUGGG "UAA"
(The last codon UAA is a stop codon or a terminater).
2. One letter amino acid code is - CODON.