Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Following is the partial sequence of the sense or coding strand o 3\' First Po s

ID: 216423 • Letter: F

Question

Following is the partial sequence of the sense or coding strand o 3' First Po s-end) Position UUU Phe UCU Ser UAU Tyr UGU Cys UUC Phe UCC Ser UAC Tyr UUA Leu UCA Ser UAA Stop UGA Stop UCCCs CUC Leu CCC Pro CAC His CGC Arg CUA LCCA ProCAA CCA Arg CUA Leu CAA Gln AUU Ile ACU Thr AAU Asn AGU Ser AGC Ser AUA lle ACA Thr AAA Lys AGA Arg AUC Ile ACC Thr AAC Asn AUG Met ACG Thr GUaGCU Ala GAU Asp GGU Gly GAC AspGGC Gly GGA Gly GGG Gly GUC Val GUA Val GUG Val GCC Ala GCA AlaGAA Glu GCG Ala 0 A. Ala-Arg-His-Val-Arg-Arg O B. Met-Tyr-Tyr-Asn-Phe O C. Met-Tyr-Ala-Gly-Gin-Leu-Gly O D. None of the above. Submit Answer Try Another Version 5 item attempts

Explanation / Answer

Given the partial sequence of the sense or coding strand:
5' - GCTAGGCATGTACGCCGGTGA - 3'
As per the codon table, the ATGTACGCCGGT-GA translates into a MetTyrAlaGly(Asp/Glu).
Hence the correct answer is D. None of the above