Below is a DNA fragment comprising the sequence of a gene coding for the human p
ID: 217110 • Letter: B
Question
Below is a DNA fragment comprising the sequence of a gene coding for the human protein CV H.
ATGAATTCGTAGGTAGGGGATCCGTACTGCAGTTGAAGCTTAAGTCCACCAAAGCTTGAATGGTCTGCAGCTGTTCCTAATGGTCAAGCTTGTGGAATTCTTGCGTAACGGATCCCCGT
Write in the case the corresponding amino acid sequence of the protein (write in this manner Leu-Gly-Leu) .
You would like to clone this gene in a plasmid next to a constitutive promoter (A constitutive promoter results in the constant transcription of a gene) and then insert this plasmid into bacteria in order to produce a high level of protein CV H. You have the choice between 3 plasmids: pA, pB and pC.
You also have the following enzymes:
EcoRI G|AATTC
BamHI G|GATCC
HindIII A|AGCTT
PstI CTGCA|G
Which plasmid would you use to clone your gene?
Which enzyme(s) would you use to cut the plasmid and the DNA fragment to facilitate the insertion of the fragment into the plasmid?
You will be asked to explain your answer in the next question.
Explain your choice of plasmid and enzymes.
Promote Multiple Cloning Sites Sites are listed in order: . HindlII .BamHI .EcoRI .Pstl pA Promoter Multiple Cloning Sites Sites are listed in order: .Pstl .BamHI . HindlII .EcoRI Promoter Multiple Cloning Sites Sites are listed in order .EcoRI . Pstl . Hindlll .BamHI pcExplanation / Answer
1. corresponding amino acid sequence of the protein Gly-Glu-Phe-Trp-Stop-Leu-Gln-Gly-Leu-Pro-Asn-Ser-Ser-Leu-Met-Asp-Glu-Phe-Ile-Stop-Ser-Leu-Met-Ile-Glu-Phe-Met-Asp-Gly-Ser-Arg-Tyr-Ser-Pro-Cys-Arg-Phe-Ile-Trp