7. The following double-stranded DNA contains sequence of a eukaryotic gene: 3\'
ID: 219079 • Letter: 7
Question
7. The following double-stranded DNA contains sequence of a eukaryotic gene: 3' TACCG GAATATTAGTCCTTT GTCGATACCGGTACTCGTGCG 5 5' CAGTCTCGGCATTATCCTATTAAAGGGAACTGAGGTGA-3 a) Transcription begins at the underlined A at base pair 17 (b) and proceeds to the right. What are the first 12 nucleotides of the resulting mRNA? Indicate the S and 3' ends of the mRNA. HIGHLIGHT THE PROMOTER REGION (3) b) The first 7 amino acids of the protein encoded by this gene are: (2) NH3t-met-ala-met-ser-thr-pro-his-tyr ???? iDunderline the nucleotides which correspond to the S untranslated region of the primary RNA transcript made from this gene. ii) draw a box around the intron region in this gene. (2) c) Consider each of the following three mutations independently. i) How would the resulting protein change if the underlined G/C base pair at position 22 (1) was deleted from the DNA sequence? Briefly explain. (3) ii) How would the resulting protein change if the underlined GC base pair at position 27 (2) was changed to a C/G base pair? Briefly explain. (3) sition 31 (3) was iii) How would the resultin deleted from the DNA sequence? Briefly explain. (3)Explanation / Answer
a) the 5' -> 3' DNA stard is called non-template strand and the 3' -> 5' strand is called template strand.
During transcription, the template strand is used as a teplate for mRNA synthesis.
Hence the mRNA synthesised in 5' -> 3' direction is
AAACAGCUAUGGCCA
During mRNA synthesis, all T's are replace by U's.
The promoter sequence is 5' TTATAAT 3'
b) the following is the mRNA of the given gene
5' AAACAGCU AUG GCC AUG AGC ACG CCA GUC UCG GCA 3'
underlined region is the 5' untranslated region.
the intron part of the mRNA is mentioned in codons.
c) IF GC base pair at position 18 is deleted, the protein sequence remains unchange. During translation of mRNA, protein synthesis start only after the first ATG is encountered.
As the mutation that is mentioned here occurs before the start codon of the gene, the protein sequence remains unchanged.
d)If the G/C base pair at position 27 was changed to C/G, the protein will be synthesised without the first 2 amino acids , that is Met and Ala.
By making this mutation, the start codon in the sequence will be changed. Hence during translation, the ribosome, will look for the next ATG after this mutated sequnce. As the next ATG appears after 2 codins or 6 bases, only the first 2 aminoacids will not be synthesised (remember 1 amino acids is coded by a codon containing 3 nucletiodes).
e) IF this mutation is made in the original sequnce, then this results in a shift in the frame of gene. That is the codons of all amino acids change and hence the protein that will obtained will be totally different from the original sequnce.