1. Imagine you have just sequenced a small bacterial (5 Points) mRNA: 5\' UCGCUG
ID: 219408 • Letter: 1
Question
1. Imagine you have just sequenced a small bacterial (5 Points) mRNA: 5' UCGCUGGGCUGAUGUUUGGCACGGCUCAGUUCAUGO CAAGUUCGCGUA GGCCGCUCGAAGAGCGAGUACACAGGCCCUCUUGCU AGUAGCGCUGGAUG-3 A) How many amino acids (including fMet) are present in the most probable (longest) polypeptide encoded by this mRNA? B) Which amino acid is located at the C-terminus of this polypeptide? C) What does "UAGCGCUGGAUG" represent in this mRNA? D) How many phenylalanine (phe) molecules are present in the polypeptide product of this mRNA? E) How many proline (pro) molecules are present in the polypeptide product of this mRNA?Explanation / Answer
Given sequence: 5'-UCGCUGGGUUGAUGUUUGGCACGGCUCAGUUCAUGCCAAAGUUCGCGUAGGCCGCUCGAAGAGCGAGUACACAGGCCCUCUUGCUAGUAGCGCUGGAUG-3'
Longest protein sequence: Met F G T A Q F M P K F A Stop (12 amino acids)
C-terminal amino acid = Alanine
The sequence 'UAG----' corresponds to 3'-UTR
Number of phenylalanine residues = 3
Number of proline residues = 1