Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

You are interested in a particular SNP that alters a recognition site for the re

ID: 224942 • Letter: Y

Question


You are interested in a particular SNP that alters a recognition site for the restriction enzyme EcoRI. The EcoRI site is shown in red: "A" allele: AGTCCACAGGATTCAAACGTCTA. "a" allele AGTCCACAGAATTCAAACGTCTA You decide to genotype this SNP in several individuals. You start by amplifying the region containing the SNP by PCR, using primers flanking the SNP. If you run out your PCR reactions on a gel immediately (without cutting with EcoRI), what results would you expect? Draw the expected results for family members who are homozygous AA, homozygous aa, and heterozygous. Draw the results you would expect if you digested your PCR products with EcoRI prior to running them on the gel.

Explanation / Answer

Answer: (The question has been answered taking into account that 23bp DNA can be seen on the gel)

EcoR1 : GAATTC

"A" allele: AGTCCACAGGATTCAAACGTCTA

"a" allele: AGTCCACAGAATTCAAACGTCTA

a. Here, it has been considered that the primers used for PCR corresponds to the end of the sequences. So, the primers will amplify the whole DNA sequence, which is 23bp.

If the gel is run right after PCR without restriction digestion with EcoRI, the following fragments will be obtained in each case:

AA: 23bp

Aa: 23bp

aa: 23bp

In all cases, the whole fragment (23bp) can be seen in the gel.

b. Upon digestion of the PCR products with EcoRI, we expect to get the following results:

AA: 23bp

Aa: 23bp, 14bp, 9bp (Heterozygous)

aa: 14bp, 9bp

The A allele do not contain the restriction site. So, homozygous AA will not get cleaved and will show the full length of 23bp.

The Aa individual is heterozygous, so will show 23bp corresponding to A and 14bp and 9bp corresponding to a.

The aa individual wil get digested completely by EcoRI and will thus produce two fragments of 14bp and 9bp.