Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The gel below shows the results of DNA sequencing reactions in which each lane c

ID: 22631 • Letter: T

Question

The gel below shows the results of DNA sequencing reactions in which each lane contains the products of the sequencing reaction run with the dideoxynucleotide indicated at the top. Deduce the DNA sequence of BOTH strands for this stretch of DNA.

http://tinypic.com/r/2hykm5h/6

Assume this DNA sequence was derived from the middle of a cDNA clone of a mammalian protein. Provide *ALL* possible amino acid sequences that could result from this DNA sequence. Is there any way to tell which might represent the true protein sequence?

Explanation / Answer

To read this, we have to start at the bottom. As for example, the smallest fragment then next and so forth. AGTTGCCAGTATGCAGCTTGA will be the sequence (check for transcription errors), and add the complementary bases. Then we have to compare this with the amino acid table. As for example, AGT could be the codon for serine. It was taken from the middle, so we cannot be sure where the reading frame is. Therefore, it could start as AGT or GTT or TGC. As this is a DNA sequence so there is no uracil. When it is transcribed and translated then we will get a different sequence. As for example the first 3 nucleotides AGT when transcribed we will get UCA which codes for serine or if we took it as GTT then it would be CAA which codes for glutamine. To get all possibilities, just change the reading frame. By this way, we will determine which is most likely look at the codon sequence and if there’s any stop or start codons, we can rule them out at this level as it’s in the middle of the sequence. We have to pick which one seems the most likely accurate, and wait till we see a real one of these.