1. A Particular DNA base sequence transcribed into mRNA is TTATCTTCGGGAGAGAAAACA
ID: 254192 • Letter: 1
Question
1. A Particular DNA base sequence transcribed into mRNA is TTATCTTCGGGAGAGAAAACA
(a) If reading begins at the left, what amino acids are coded by this sequence? (Note: the initiation sequence is disregarded in this example)
(b) If Proflavine treatment caused deletetion of the first adenine nucleotide on the left, what changes would occur in the first six amino acids coded by this sequence?
2. Streisinger and co-workers studied amino acid sequences in the lysozyme protein produced by the T4 phage. One sequence is Lys-Ser-Pro-Ser-Leu-Asn-Ala, but as a result of a deletion of a single nucleotide and subsequent insertion of another nucleotide, this amino acid sequence was found to change to Lys-Val-His-His-Leu-Met-Ala. Using the codons Table 17B-1, determine the nucleotide sequences that produced:
(a) the original amino acid sequence
(b) the subsequent changes.
Below is the table
E 5 X + - , WebWork : EGR265_14 n A C Chegg Study Guided S C 3. A Certain Population Please help answer this BY 123L case study G Biology in the Labo books.google.com/books?id=Fw54Ce6DfPYC&pg;=5417-PA17&lpg;=SA17-PA17&dq;=Streisinger+and+co-workers+studied + aminoacid+sequences - * X ...Explanation / Answer
Given the DNA sequence is
5'- TTATCTTCGGGAGAGAAAACA-3'
From this sequence, mRNA will be formed which will have complementary bases. So the mRNA sequence will be:
AAUAGAAGCCCUUCUCUUUUGU
From this sequence, amino acid will be produced as:
Asp-Arg-Ser- Pro- Ser- Leu- Leu
Now, if first adenine in the DNA is DELETED:
Then the new DNA sequence will be:
5'- TTTCTTCGGGAGAGAAAACA-3'
And the new mRNA sequence will be:
AAAGAAGCCCUUCUCUUUUGU
This will lead to change in polypeptide sequence:
Lys- Glu- Ala-Leu- Leu- Phe- Cys
---------------------------------------------------------------
Answer 2:
The original polypeptide sequence is : Lys-Ser-Pro-Ser-Leu-Asn-Ala
So, the mRNA sequence for this polypeptide sequence will be:
5’- AAAUCACCUUCCCUUAAAUGCC - 3’
The original amino acid sequence is modified to:
Lys-Val-His-His-Leu-Met-Ala
So the new nucleotide sequence is:
AAAGUUCAUCAUCUUAUGGCC