2. A short fragment of a human gene is shown below. gaaccactca gggtcctgtg gacagc
ID: 261825 • Letter: 2
Question
2. A short fragment of a human gene is shown below.
gaaccactca gggtcctgtg gacagctcac gaattcctag ctgcaatggc tacaggctcc
cggacgtccc tgctcctggc ttttggcctg ctctgcctgc cctggcttca agagggcagt
gccttcccaa ccattccctt atccaggctt tttgacaacg ctatgctccg cgcccatcgt
ctgcaccagc tggcctttga cacctaccag gagtttgaag aagcctatat cccaaaggaa
cagaagtatt cattcctgca gaacccccag acctccctct gtttctcaga gtctattccg
acaccctcca acagggagga aacacaacag aaatccaacc tagagctgct ccgcatctcc
ctgctgctca tccagtcgtg gctggagccc gtgcagttcc tcaggagtgt cttcgccaac
agcctggtgt acggcgcctc tgacagcaac gtctatgacc tcctaaagga cctagaggaa
ggcatccaaa cgctgatggg gaggctggaa gatggcagcc cccggactgg gcagatcttc
aagcagacct acagcaagtt cgacacaaac tcacacaacg atgacgcact actcaagaac
tacgggctgc tctactgctt caggaaggac atggacaagg tcgagacatt cctgcgcatc
gtgcagtgcc gctctgtgga gggcagctgt ggcttctagc tgcccgggtg gcatccgaat
tcctgtgacc cctccccagt gcctctcctg gccctggaag ttgccactcc agtgcccacc
agccttgtcc taataaaatt aagttgcatc aaaa
a. Using a web-based tool such as ORFfinder or Expasy, find the longest open reading frame (ORF), meaning: the largest stretch of sequence starting with a methionine codon where there are encoded amino acids with no stop codons. Remember that the sequence above might be the coding or the non-coding strand. Highlight the start and stop codons in the above sequence.
Explanation / Answer
atg gctacaggctcccggacgtccctgctcctggcttttggcctgctctgcctgccctgg cttcaagagggcagtgccttcccaaccattcccttatccaggctttttgacaacgctatg ctccgcgcccatcgtctgcaccagctggcctttgacacctaccaggagtttgaagaagcc tatatcccaaaggaacagaagtattcattcctgcagaacccccagacctccctctgtttc tcagagtctattccgacaccctccaacagggaggaaacacaacagaaatccaacctagag ctgctccgcatctccctgctgctcatccagtcgtggctggagcccgtgcagttcctcagg agtgtcttcgccaacagcctggtgtacggcgcctctgacagcaacgtctatgacctccta aaggacctagaggaaggcatccaaacgctgatggggaggctggaagatggcagcccccgg actgggcagatcttcaagcagacctacagcaagttcgacacaaactcacacaacgatgac gcactactcaagaactacgggctgctctactgcttcaggaaggacatggacaaggtcgag acattcctgcgcatcgtgcagtgccgctctgtggagggcagctgtggcttc tag
Start codon is ATG and stop codon is TAG. It is highlighted in the ORF. THe longest ORF starts at 46 and ends at 699. This codes for 217 amino acids.