11. The diagram below depicts two nucleic acid molecules, and the base pair sequ
ID: 262288 • Letter: 1
Question
11. The diagram below depicts two nucleic acid molecules, and the base pair sequences found at the splicing donor/acceptor sites 205 AATAAATGACTTCTAGAAAGA 253 363 409 4 494 GA 3' (a) Do the top boxes (dispersed throughout the red line) represent template DNA or coding DNA? (b) Does the bottom molecule represent DNA, pre-mRNA, or mRNA? (c) What do the dark grey boxes represent? What are the light grey boxes? (d) What do the numbers below the top boxes (253 to 1205) represent? (e) Is GT...AG included in the exons or in the introns? () Based on the diagram, how many introns does this gene contain?Explanation / Answer
a-template strand
b-mrna
C-coding sequence .non coding sequence
D-nucleotide base
E-exon
F- 3
Note - there is post translation process going where introns are removed and exons are joined to form mature mrna.