Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The given situation is in regards to a single cell with cellular dysfunction and

ID: 270349 • Letter: T

Question

The given situation is in regards to a single cell with cellular dysfunction and it's showing these symptoms:

Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

- Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

- Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

the cell has defective:

NADH dehydrogenase complex

Cytochrome bc-1 complex

cytostome oxidase complex.

How can enzyme replacement therapy fix these problems? Please explain.

Explanation / Answer

Enzyme replacement therapy is a therapy that is associated with replacement of an enzyme which is absent or deficient in the body. In this the genes will be pushed and treated so that it is able to produce high level of the enzyme that is deficient. It helps in treating the congenital enzyme deficiencies by preparing recombinant enzymes that is incorporated in the cell and it helps in preventing the other dysfunctions. In case of single cells there are mannose molecules attached to the replacement enzymes which allows binding of the macrophages and it enters the cell facilitating normal cellular function.