Case D: 33-year-old male investment broker living in Dallas with history of trav
ID: 270612 • Letter: C
Question
Case D: 33-year-old male investment broker living in Dallas with history of travel to Las Vegas 3 weeks ago. The patient complains of a purulent urethral discharge and dysuria for 3 days. He became sexually involved with a new female partner (Laura) 2 months ago. Robert states Laura is asymptomatic. Robert states he also had a one-time sexual encounter with a woman he met in Las Vegas 3 weeks ago (Monica). No condoms used. Vital signs: blood pressure 9872, pulse 68, respiration 14, temperature 37.2"C o Cooperative, good historian Chest, heart, musculoskeletal, and abdominal exams within normal limits No flank pain on percussion, normal rectal exam, no sores or rashes The genital exam reveals a reddened urethral meatus with a purulent discharge, without lesions or lymphadenopathy. 1. What symptoms should be taken into account for the differential diagnosis? (1pt) Which laboratory tests would be appropriate to order or perform to diagnose this infection? (1pt) 2. 3. Which is the most likely pathogen causative of this infection? (1pt)Explanation / Answer
Answer 1) Symptoms should be taken for diagnosis:
blood pressure-98/72, pulse 68, respiration-14, body temperature, and urethral disharge.
other symptoms of urethritis:
Answer 2)
Following counseling,
a) urethral and ocular swabs, and blood sample were aseptically obtained and streaked immediately on Thayer Martin and chocolate agar plates then incubated overnight at 37°C in the presence of 5% CO2.
b)Following the incubation period, Grayish white, transparent to opaque, slightly raised colonies with 1–2 mm diameter were observed.
c)After Gram-staining, pink to red diplococci with coffee bean-shaped cells opposing each other on the concave sides. This result was sufficient for the presumptive identification of N. gonorrhoeae.
d)Furthermore, numerous polymorphonuclear cells with intracellular diplococci, were microscopically detected in the urethral smear.
e)Cytochrome C oxidase was tested using the commercially available strips (Biolife, Italy) impregnated with N,N,N?,N? tetramethyl-p-phenylenediamine dihydrochloride and dried.
f)A deep blue color appeared within 30 s indicating a positive result.
g)The test pathogens were also identified by the matrix-assisted laser desorption-ionization time-of-flight (MALDI-TOF) in the Microbiology Department, Faculty of Medicine, Alexandria University using Bruker Daltonik MALDI Biotyper, Germany.
g)For confirmation, polymerase chain reaction (PCR) was utilized to amplify the pathogenic DNA in the presence of specific primers. Amplicons with 390 bp were detected in the electrophoregram.
h)Using Kirby–Bauer disk diffusion method, susceptibility testing of the recovered isolates was performed against different antimicrobials. N. gonorrhoea ATCC 49226 was used as a quality control strain. The results of susceptibility testing were interpreted according to CLSI.
i)It revealed multiple drug resistance to ampicillin, ampicillin/clavulanic acid, cephradine, cefotaxime, cefepime, cefuroxime, ceftriaxone, ciprofloxacin, chloramphenicol, sulfamethoxazole, trimethoprim, tetracycline, doxycycline, and spectinomycin.
j) The minimum inhibitory concentration (MIC) was determined in order to calculate the fold increase in resistance. It was noted that the resistance patterns of the three strains isolated from the three body sited were the same. ?-lactamase production was detected using nitrocefin test.
k)The yellow color of nitrocefin solution (Oxoid, England) was quickly turned into red indicating positive result. Random Amplified Polymorphic DNA (RAPD) was performed using different arbitrary primers including; ITS3 (5?-GCATCGATGAAGAACGCAGC), VIM-fw (5?-GTACGCATCACCGTCGACAC), Bla NDM-1 -R GTAGTGCTCAGTGTCGGCAT D8635 (5?-GAGCGGCCAAAGGGAGCAGAC), D11344 (5?-AGTGAATTCGCGGTGAGATGCCA) (6, 7) in order to detect if the three strains isolated from different body sites were the same or different.
k)It revealed identical patterns for both strains isolated from urethral discharge and ocular swab suggesting autoinfection through the accidental contamination of the eyes by urethral discharge.
l)However, the strain isolated from blood showed different pattern confirming that pathogenesis was due to two different strains of N. gonorrhoeae.
m)This might explain the early appearance of arthritis symptoms.
Answer 3) The infection is due to N. gonorrhoeae bacteria.