10. The two alleles of the PV92 locus (that you studied in lab) are shown below.

Question

10. The two alleles of the PV92 locus (that you studied in lab) are shown below. The "+" allele has the 300 bp "Alu" insertion sequence inserted into the "-" allele as shown. The dotted lines are placed every 5 bp to help with counting "-"allele: 5' GCGTGCAGATCGATACGATAGATCTTAATG 3' 3' CGCACGTCTAGCTATGCTATCTAGAATTAC 5 "+" allele5' GGGCTCGTAC (280nt)TAAACGATAG 3' insertion:3' CCCGAGCATG (280nt)ATTTGCTATC 5' a. Circle two of the following primers for PCR vou could use to genotype individuals at the PV92 locus. 5 CATTAAG3 5 GGGCTCG3' 5 GCGIGCA3' 5 ' CTATCGT3 5 CCCGAGC3' b. What is the size of the strands you would expect to amplify for each allele? "+" allele: p"-" allele: Which of the primers you chose in "a" would bind more "tightly" to the template DNA? Why? c.

Explanation / Answer

a.5’ CATTAAG 3’

   5’ GCGTGCA 3’

b. + allele: 330 bp

    - allele: 30 bp

c. 5’ GCGTGCA 3’ would bind more tightly than the other primer because it has more GC content than the other. GC forms triple bonds, whereas AT forms double bonds.

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

---