Recitation head 3) (34 pts) In a newly discovered animal, chromosome 3 contains
ID: 272512 • Letter: R
Question
Recitation head 3) (34 pts) In a newly discovered animal, chromosome 3 contains a dominant mutation stripe, which causes a recessive lethal phenotype during larval stages. Several mutant animals carrying recessive lethal mutations on chromosome 3 were isolated and kept in stocks as trans-heterozygotes with stripe (i.e., mutant/stripe). These stocks were then crossed to each other (i.e., mut1/stripe x mut2/stripe) and their progeny (including dead carcasses) were examined. Listed in the table below is the number of progeny that are wild type (i.e., NOT stripe). mutant # 2 250 0 3. 12211250 10 - 4 ?300-136010 0 280 120 1400 150 180 120 130 180o 200 160 225 130 210 1580 100 175 201 101130 150 1700 350 280 260 330 256 0 180 280 0 350 165 190 220 145 310 0 250 195 0 10 A. What are the complementation groups? B. You isolate 9 additional non-lethal mutants that are in the same complementation group as mutant 3. EcoRI CAT primer 1 primer 2 The sequence below is the region surrounding gene X. Design DNA primers 1 and 2 (5 nucleotides ONLY) to amplify this region. Indicate the polarity of the primers. A AGGATAACATGCCCATCATCAAGGAGTTCA I. Primer 1: 5'- II. Which is the template strand for transcription? Circle ONE: A III. Which is the 3' end of the DNA? Circle ONE: A or B Primer 2: 5'- or BExplanation / Answer
Complementation groups- (1,5), (2,4), (3), (6,9), (7,10), (8)
6 complementation groups.
B.
Strand A- 5’-3’
Strand B- 3’-5’
Primer1: 5’-AGCAT-3’
Primer2: 5’-CTCGC-3’
Template strand for transcription- strand B
3’ end- B