The polymerase chain reaction (PCR) is a commonly used to amplify trace amounts
ID: 273697 • Letter: T
Question
The polymerase chain reaction (PCR) is a commonly used to amplify trace amounts of DNA to detectable levels. The reaction involves the extension of two primers by Taq DNA polymerase in the presence of nucleotide triphosphates. The two PCR primers are designed to hybridise to a specific region of DNA at a particular temperature with a magnesium concentration between 2 and 4 millimolar (mM). Upon hybridization, the 3 region of one primer is extended by Tadq polymerase. The second primer can then hybridise to the extended DNA template and the 3 end of the second primer is then extended by Taq polymerase to generate a PCR amplicon. The aim of task 2 is to design two 20-25 nucleotide DNA primers to amplify the Arginine Vasopressin Receptor 1A gene (AVPR1A) or your chosen gene from task 1. This task should be no longer than 1 page and should follow the numerical format outlined below: 1. Copy and paste the gene sequence (or part of it) and the web address of the gene (e. URL). 2. Assess if the sequence is RNA or complementary (c)DNA. 3. Identify the 5 end and the 3 end of the cDNA sequence. 4. Highlight a 20-25 nucleotide region of the cDNA where you would like your first PCR primer to hybridise 5. Write the DNA sequence of your first PCR primer (5-3)Explanation / Answer
1)taattgcttgaaggattttttccagacaggtggtctggaaaccttttacctattaccttccatccctgaaccatttcaatcttctgcctcctggatatcttggagaaaat gaaccaacacaacacagctttcagtttttagagcatttcccccatacagaacattgtcttacttgatcttcccgatgacctcaacaacaggaaaggcaggtcctttcatttccatttataagacgcacagacccaggattatctagccacaggaagcaggactccagatttcaagtccagcatctcaacgtgacaaccttggtaactctgcatgaacgga ctggatagta aagtggaattattactgagaactgcaatgaataaaatcttttgcattttttgcctacgtttcacagagggtgatattttt
https://www.ncbi.nlm.nih.gov/nuccore/NC_000012.12?report=genbank&from=63142759&to=63152810&strand=true?
2) cDNA
3)
3' end - AAGTCCATCAAATTCATTCCTGTTTCAACTTGA (highlighted in bold at the end of sequence)
4) CTTCCAGGTGCTGCCGCAAATGTGCT ( same sequence highlighted in italics above)
5) 5' AGCACATTTGCGGCAGCACCTGGAAG 3'