23 Which of the following represents the annotation c.1462dupTA41 ?) 5\', ATCAC
ID: 282094 • Letter: 2
Question
23 Which of the following represents the annotation c.1462dupTA41 ?) 5', ATCAC TATA TACAGA TAJ' B)S ATCACTAATAATAACAGATA3 C)5ATCACTATACAGATA 3 . ATCACTATATATACAGATA 3 .ATCACTATATTACAGATA3 D) 5" E)5 24. Which of the following represents the annotation p.Gly 17Thr A) 5. Asnl ysAspThAug3 B) 5.. AsnL ysAspTyrAug..3 C)5.. ACGACACACACG...3 D) 5... ACGACACACG...3 25. Which of the following could desoribe mutations that would result in this 16 bp DNA sequence 5 ATAGCACGATCAGTAC-3'? A TGC 26. The picture to the right represents A) Sanger sequencing D) sequencing by ligation C) Sequencing by synthesis 27. The generation of light is used by which sequencing procedure? A) Sanger sequencing B) Pyrosequencing C) Fire sequencing D) Porous sequencing E) ion semi-conductor sequencing 28. Next generation sequencing technique unable to accurately sequence (long strings of the same nucleotide) A) Sanger sequencing B) Pyrosequencing C) Sequencing by synthesis D) sequencing by ligation E) ion semi-conductor sequencing 29) Which of the following may render a silent mutation in an mRNA relevant? A) microRNA B) SiRNA C) tRNA D) Pyrosequencing E) Random Mating 30) A c.BG>C mutation from t sequence). Beginning from the start codon, answer the following 5- ATGGTTACTCAATGTTCTTTAATT-3 A) Give the wild-type polypeptide using single letter codes (4 pts) B) Give the mutant polypeptide using single letter codes (4 pts) C) In terms of polypeptide properties (polar, nonpolar, basic, acidic, aromatic).h from the wild-type (4 pts)? D) Using the DNA base pairs (basically like SNPs) create a Punnett square with a h type/mutant mating to a heterozygous wild-type/mutant (6 pts) E) What is the percent chance of carriers (from D above) if this mutation is dominant (4 pts)? F) What is the percent chance of affected (from D above) if this mutation is dominant (4 pts)? eterozygous wild- 31) The carriers of a mutation are all resistant to cholera but assumptions in order of importance to these carriers (most important first) AND describe why you picked this order (10 pts). have fewer children. List the Hardy WeinbergExplanation / Answer
23 . D - four times TA duplication
24. D
25. B & D
26. A - Sanger sequencing
27. B - Pyrosequencing
28. E- Ion semiconductor sequencing
30. A) ATGGTTACTCAATGTTCTTTAATT - MVTQCSLI (Polypeptide sequence)
B) ATGGTTAGTCAATGTTCTTTAATT - MVSQCSLI (Polypeptide sequence)
C) Not much difference. Only threonine is replaced by serine. Both of this amino acids are polar in nature.
Hope this helps. Pls ask any specific queries in comments. Difficult to write down explanation of each and everything due to space limitation.