Explain the assembly strategy you would use to combine the DNA parts below to ma
ID: 300467 • Letter: E
Question
Explain the assembly strategy you would use to combine the DNA parts below to make "ICE-CREAM". Use the iGEM standard assembly method (RFC 10) to do this. Assemble the "ICE-CREAM" parts by moving the "ICE" part out of the plasmid that it is in and into the "CREAM" plasmid. Answer this question in point form using a numbered list. Each point/step in your answer should have two sections: a) describe what yoiu would do, and b) what would be produced (the result) Eg. 1. a) EcoRI Not Xbal sSpel NoPstl Length 500 base pairs GAATTCGCGGCCGCTTCTA CTTAAGCGCCGGCGAAGATCT ICE CTAGTAGCGGCCGCTGCAG GATCATCGCCGGCGACGTC Length 1000 base pairs Notl Length 2000 base pairs AMPR GCGGCCGCT CGCCGGCGA EcoRI NotXbal Length 1000 base pairs Spel NotPstl GAATTCGCGGCCGCTTCTA GATCATCGCCGGCGACGTC Length 1000 base pairs Notl Length 2000 base pairs AMPR GCGGCCGCT CGCCGGCGAExplanation / Answer
1. Digest the plasmid containing ICE with restriction enzymes EcoR1 and Spe1
This will generate a fragment which will contain:
Not1-Xba1-ICE-TGATG (overhang of Spe1)
2. Digest the plasmid containing CREAM with restriction enzymes Xba1 and Pst1.
This will generate a fragment as: 5' CTAGA-CREAM-Spe1-Not1
3. Both the fragments can be anealled to by mixing them in equimolar ratio and incubating at temperatures gradually decreasing from 98 to 50 degrees.
Also PCR can be done to amplify the desired fragment after annealing prefix and suffix. Design forward and reverse primers for the fragment and amplify by using PCR.
This can be simply achieved by boiling water till 100 degree celcius, keep it on a table top. Put the vial of mixture of both fragments properly packed to avoid lickage. Let it cool overnight. Remove the vial after water is cools down to room temperature.Do the PCR after this stage or can be directly used for cloning.
So this frament will now contain:
EcoR1-Not1-Xba1-ICEmixedXba1/Spe1-CREAM-Spe1-Not1-Pst1
4. Digest an empty plasmid with EcoR1 and Spe1
Digest the combined fragment with Xba1 and Pst1
Ligate with ligase enzyme.